Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154P02

Clone ID RBdS154P02
HP ID HP06732
Gene ID 2517
Gene Symbol FUCA1
Protein Name fucosidase, alpha-L- 1, tissue
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000147.3
Length of RefSeq (bp) 2095
Chromosome 1p34
Reference DDBJ accession
UniGene Hs.370858
5'-terminal sequence GAGCGATGCGGGCTCCGGGGATGAGGTCGCGGCCGGCGGGTCCCGCGCTGTTGCTGCTGC
2011.08.28