Prev. |  KEGG KO K00522 > 

RIKEN DNA Bank Human Resource - FTH1

Gene ID NCBI Gene 2495 |  KEGG hsa:2495
Gene Symbol FTH1
Protein Name ferritin heavy chain 1
Synonyms FHC|FTH|FTHL6|HFE5|PIG15|PLIF
Ortholog resources KEGG ortholog (KEGG orthology K00522) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19188 FTH1-GFP Expression vector of human FTH1 tagged with GFP at C-terminus.

webcatalog20210331.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001666 IRAK004C18 pCMV-SPORT6 BC000857 NM_002032 Full
HGX004920 IRAK012E24 pCMV-SPORT6 BC011359 NM_002032 Full
HGX008224 IRAK020J08 pCMV-SPORT6 BC016857 NM_002032 Full
HGX008426 IRAK021B02 pCMV-SPORT6 BC013724 NM_002032 Full
HGX008818 IRAK022A18 pCMV-SPORT6 BC015156 NM_002032 Full
HGX053669 IRAK134C21 pCMV-SPORT6 BC063514 NM_002032 Full
HGY066856 IRAK167C08 pBluescriptR BC066961 NM_002032 Full
HGY067227 IRAK168B03 pBluescriptR BC066341 NM_002032 Full/var
HGX069714 IRAK174E18 pCMV-SPORT6 BC070494 NM_002032 Full
HGY081951 IRAL004O15 pOTB7 BC001399 NM_002032 Full
HGY095385 IRAL038H17 pDNR-LIB BC016009 NM_002032 Full
HGY103429 IRAL058J13 pOTB7 BC073750 NM_002032 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040406 ARe01A06 pKA1U5 NM_002032.2  
ATCCTGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTTCCTGCTTCAACAGNTGCTTGG
HKR040408 ARe01A08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR040852 ARe02C04 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR041258 ARe03C10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGNTGCTTGGACGGAAC
HKR041658 ARe04C10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGCTTTCCTGCTTCAACAGNTGCTTGGACGGAA
HKR042030 ARe05B06 pKA1U5 NM_002032.2  
ATCCTGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGAC
HKR042475 ARe06D03 pKA1U5 NM_002032.2  
ATCCTGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGAC
HKR042477 ARe06D05 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR043329 ARe08F09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR043625 ARe09B01 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR044084 ARe10D12 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR044098 ARe10E02 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCNTTCAACAGTGCTTGGACGGAAC
HKR044860 ARe12C12 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR046408 ARe16A08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR047370 ARe18H02 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR048553 ARe21G09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR048978 ARe22H10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR049280 ARe23D08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGCTTTCCTGCATTCAACAGATGCTTGGACGGA
HKR049702 ARe24E06 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGNTTCAACAGTGCTTGGACGGAACC
HKR050411 ARe26A11 pKA1U5 NM_002032.2  
AGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR050430 ARe26B06 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR051236 ARe28B12 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR051255 ARe28C07 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR051256 ARe28C08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR051280 ARe28D08 pKA1U5 NM_002032.2  
GCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR051705 ARe29E09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR053380 ARe33H12 pKA1U5 NM_002032.2  
GGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA
HKR053608 ARe34A08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR053633 ARe34B09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR054527 ARe36F07 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR054897 ARe37E01 pKA1U5 NM_002032.2  
ATCCTGGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGA
HKR054954 ARe37G10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR055227 ARe38B03 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR056506 ARe41E10 pKA1U5 NM_002032.2  
GAGACGCTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR058409 ARe46A09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR058804 ARe47A04 pKA1U5 NM_002032.2  
GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
HKR059207 ARe48A07 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR059631 ARe49B07 pKA1U5 NM_002032.2  
GGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA
HKR060453 ARe51C05 pKA1U5 NM_002032.2  
GCAGACGTTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR061725 ARe54F05 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR062098 ARe55E02 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCATTCAACAGTGCTTGGACGGAAC
HKR062155 ARe55G11 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGCTTNCCCTGTTTTCAACAGNTGCTTGGACGG
HKR062857 ARe57C09 pKA1U5 NM_002032.2  
GAGACGTTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR064830 ARe62B06 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR065281 ARe63D09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR065721 ARe64F01 pKA1U5 NM_002032.2  
ATGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR066099 ARe65E03 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR066128 ARe65F08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR066145 ARe65G01 pKA1U5 NM_002032.2  
TTGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR068500 ARe71E04 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR069203 ARe73A03 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGNTTCAACAGNTGCTTGGACGGAAC
HKR069375 ARe73H07 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGACGTCGGGGTTCCCCGTTAANAACAGNGCTTGGACGGAAC
HKR070977 ARe77H09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTNCCCNTTTANCAACAGTGCTTGGACGGAAC
HKR071727 ARe79F07 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR072507 ARe81E11 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR072953 ARe82G09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR073204 ARe83A04 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR073258 ARe83C10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR073259 ARe83C11 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR073608 ARe84A08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR074076 ARe85D04 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR074108 ARe85E12 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR074921 ARe87F01 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR075349 ARe88G05 pKA1U5 NM_002032.2  
TGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGNTGCTTGGACGGAA
HKR075723 ARe89F03 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR075752 ARe89G08 pKA1U5 NM_002032.2  
GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
HKR076151 ARe90G07 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR076178 ARe90H10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR076883 ARe92D11 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR077651 ARe94C03 pKA1U5 NM_002032.2  
TGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR078059 ARe95C11 pKA1U5 NM_002032.2  
TGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR078176 ARe95H08 pKA1U5 NM_002032.2  
TGTGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGG
HKR078812 ARe97A12 pKA1U5 NM_002032.2  
GNATACCTTCTTNGCCGAGAGNTCGCCGGGGCNTTCCTGTGTTCNGNGGAGCGTTGNTCN
HKR078881 ARe97D09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR078930 ARe97F10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR079201 ARe98A01 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR080456 ARf01C08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGNTGCTTGGACGGAAC
HKR080829 ARf02B05 pKA1U5 NM_002032.2  
TGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR081304 ARf03E08 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGNTGCTTGGACGGAAC
HKR081730 ARf04F10 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR082524 ARf06F04 pKA1U5 NM_002032.2  
GCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGATGCTTGGACGGAACCCGGCGC
HKR082804 ARf07A04 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR082897 ARf07E01 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR160483 ARi01D11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR160898 ARi02E02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR161636 ARi04B12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR161681 ARi04D09 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR162152 ARi05G08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR162453 ARi06C05 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR163704 ARi09E08 pGCAP10 NM_002032.2  
GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
HKR164080 ARi10D08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR164107 ARi10E11 pGCAP10 NM_002032.2  
TGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR164956 ARi12G12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR165210 ARi13A10 pGCAP10 NM_002032.2  
TGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR165282 ARi13D10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR165658 ARi14C10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR166060 ARi15C12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR166127 ARi15F07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR166132 ARi15F12 pGCAP10 NM_002032.2  
CGGCCGGCCGATGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGC
HKR166180 ARi15H12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCNACAGTGCTTGGACGGAACC
HKR166431 ARi16B07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR166482 ARi16D10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR168026 ARi20B02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR168122 ARi20F02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR168483 ARi21D11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR168506 ARi21E10 pGCAP10 NM_002032.2  
GATCTGTTCCTCCGCGACAGGCTTCCGGGTTTCCTGCTTANACNGTGCTTGTACGGAATC
HKR168524 ARi21F04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR168807 ARi22A07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR169326 ARi23F06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR169604 ARi24A04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR169656 ARi24C08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170104 ARi25E08 pGCAP10 NM_002032.2  
GGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACNGTGCTTGGACGGAACCC
HKR170106 ARi25E10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170121 ARi25F01 pGCAP10 NM_002032.2  
GGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA
HKR170171 ARi25H03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170172 ARi25H04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170175 ARi25H07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACNGTGCTTGGACGGAACC
HKR170402 ARi26A02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170550 ARi26G06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170873 ARi27D01 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR170902 ARi27E06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR172027 ARi30B03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR172504 ARi31E08 pGCAP10 NM_002032.2  
GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
HKR172810 ARi32A10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR172930 ARi32F10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR172972 ARi32H04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR174084 ARi35D12 pGCAP10 NM_002032.2  
CAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR174882 ARi37D10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR175252 ARi38C04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR175601 ARi39A01 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR176051 ARi40C03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR176098 ARi40E02 pGCAP10 NM_002032.2  
CGGCCGGCCGATGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGC
HKR176880 ARi42D08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR176948 ARi42G04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR177280 ARi43D08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR177331 ARi43F11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR177374 ARi43H06 pGCAP10 NM_002032.2  
GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
HKR177636 ARi44B12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR177725 ARi44F05 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR178006 ARi45A06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR178881 ARi47D09 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR179377 ARi48H09 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR180007 ARi50A07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR180545 ARi51G01 pGCAP10 NM_002032.2  
CGGCCGGCCGATGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGC
HKR180879 ARi52D07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR180974 ARi52H06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR181634 ARi54B10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR181679 ARi54D07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR181708 ARi54E12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR182106 ARi55E10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR182124 ARi55F04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR182172 ARi55H04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR182402 ARi56A02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR183204 ARi58A04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR184177 ARi60H09 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR184852 ARi62C04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR184949 ARi62G05 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR185254 ARi63C06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR185273 ARi63D01 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR186009 ARi65A09 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR186123 ARi65F03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR186126 ARi65F06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR186410 ARi66A10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR186450 ARi66C02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR187650 ARi69C02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR188436 ARi71B12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR203264 ARiS008C16 pGCAP10 NM_002032.2  
GAGNCNTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR203315 ARiS008E19 pGCAP10 NM_002032.2  
GTGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR203452 ARiS008K12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR203469 ARiS008L05 pGCAP10 NM_002032.2  
CAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR205244 ARiS013B20 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR205370 ARiS013H02 pGCAP10 NM_002032.2  
AGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCC
HKR205376 ARiS013H08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR205495 ARiS013M07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCNANAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR205542 ARiS013O06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR205544 ARiS013O08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR208093 ARiS020D21 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR208135 ARiS020F15 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR208145 ARiS020G01 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR208281 ARiS020L17 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR209224 ARiS023A24 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR209229 ARiS023B05 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR209356 ARiS023G12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR209543 ARiS023O07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR218003 ARiS045A03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR218154 ARiS045G10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR218258 ARiS045K18 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGANAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR219631 ARiS049B07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR219752 ARiS049G08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR219846 ARiS049K06 pGCAP10 NM_002032.2  
GAGACGTTCTTCNNCNAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACNGAACC
HKR222119 ARiS055E23 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR222130 ARiS055F10 pGCAP10 NM_002032.2  
GGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR222246 ARiS055K06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR222354 ARiS055O18 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234044 ARiS085B20 pGCAP10 NM_002032.2  
GGGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234106 ARiS085E10 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234134 ARiS085F14 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234215 ARiS085I23 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234237 ARiS085J21 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234366 ARiS085P06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR234859 ARiS087C11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR235217 ARiS088A17 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR235253 ARiS088C05 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR235305 ARiS088E09 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR235346 ARiS088G02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR235404 ARiS088I12 pGCAP10 NM_002032.2  
TTGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA
HKR235424 ARiS088J08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR235483 ARiS088L19 pGCAP10 NM_002032.2  
GCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR235524 ARiS088N12 pGCAP10 NM_002032.2  
GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
HKR235566 ARiS088P06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR238484 ARiS096D12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR238615 ARiS096I23 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR238617 ARiS096J01 pGCAP10 NM_002032.2  
TTGGGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGG
HKR238636 ARiS096J20 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR238723 ARiS096N11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR243780 ARiS109H12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR243792 ARiS109H24 pGCAP10 NM_002032.2  
CAGACNTTCTTCNCCNANAGTCCTCGGGGTTTCCNGCTNNAACANTGCTTGGACGGAACC
HKR243859 ARiS109K19 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR243950 ARiS109O14 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR247379 ARiS118H11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR247413 ARiS118I21 pGCAP10 NM_002032.2  
CGGCCGGCCGATGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGC
HKR247484 ARiS118L20 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR247548 ARiS118O12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR247572 ARiS118P12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR248817 ARiS122A17 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR248911 ARiS122E15 pGCAP10 NM_002032.2  
GAGACGTTCTTCNCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR260040 ARiS150B16 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR260116 ARiS150E20 pGCAP10 NM_002032.2  
GGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA
HKR260164 ARiS150G20 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR260236 ARiS150J20 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR260250 ARiS150K10 pGCAP10 NM_002032.2  
GGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA
HKR260276 ARiS150L12 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR260295 ARiS150M07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR260383 ARiS150P23 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR264632 ARiS161J16 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR264666 ARiS161L02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR264774 ARiS161P14 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR276471 ARiS191C23 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR276478 ARiS191D06 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR276550 ARiS191G06 pGCAP10 NM_002032.2  
CCGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR276589 ARiS191H21 pGCAP10 NM_002032.2  
GCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR276619 ARiS191J03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR277611 ARiS194A11 pGCAP10 NM_002032.2  
TTGAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAA
HKR279223 ARiS198A23 pGCAP10 NM_002032.2  
HKR279280 ARiS198D08 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR279395 ARiS198I03 pGCAP10 NM_002032.2  
GAGNCGNNCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR279417 ARiS198J01 pGCAP10 NM_002032.2  
HKR279532 ARiS198N20 pGCAP10 NM_002032.2  
GAGNCGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR279551 ARiS198O15 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR320508 RBb01E12 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR321329 RBb03F09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR321350 RBb03G06 pKA1U5 NM_002032.2  
HKR321380 RBb03H12 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR326481 RBb16D09 pKA1U5 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR327234 RBb18B10 pKA1U5 NM_002032.2  
GCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAAC
HKR337684 RBb44D12 pGCAP1 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGATGCTTGGACGGAAC
HKR338122 RBb45F02 pGCAP1 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR340425 RBb51B01 pGCAP1 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGATGCTTGGACGGAAC
HKR343632 RBb59B08 pGCAP1 NM_002032.2  
HKR344954 RBb62G10 pGCAP1 NM_002032.2  
HKR363604 RBd09A04 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR364931 RBd12F11 pGCAP10 NM_002032.2  
HKR368825 RBd22B01 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR372175 RBd30H07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR372551 RBd31G07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR373727 RBd34F07 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR390546 RBd76G02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR390802 RBd77A02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR395773 RBd89H05 pGCAP10 NM_002032.2  
GGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGCGCTCGTT
HKR398970 RBd97H02 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR402816 RBdS007A16 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR420713 RBdS051N01 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR430179 RBdS075H11 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR452934 RBdS132F14 pGCAP10 NM_002032.2  
GATAAGAGACCACAAGCGACCCGCAGGGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTT
HKR452944 RBdS132F24 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR452985 RBdS132H17 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR461833 RBdS154J17 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR461915 RBdS154N03 pGCAP10 NM_002032.2  
GAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACC
HKR462535 RBdS156F15 pGCAP10 NM_002032.2  
GGCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.10.02

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl