Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARe47A04

Clone ID ARe47A04
HP ID HP00492
Gene ID 2495
Gene Symbol FTH1
Protein Name ferritin, heavy polypeptide 1
Vector pKA1U5
Accession No. in DDBJ
RefSeq NM_002032.2
Length of RefSeq (bp) 1245
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.524910
5'-terminal sequence GGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGC
2011.08.28