Prev. |  KEGG KO K04437 > 

RIKEN DNA Bank Human Resource - FLNC

Gene ID NCBI Gene 2318 |  KEGG hsa:2318
Gene Symbol FLNC
Protein Name filamin C
Synonyms ABP-280|ABP280A|ABPA|ABPL|CMH26|FLN2|MFM5|MPD4|RCM5
Ortholog resources KEGG ortholog (KEGG orthology K04437) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182802 ARi57A02 pGCAP10 NM_001458.4 done
ACTTCCCGAGCACCGCTCCGACCCTGGAGGGAGAGAGAGCCAGAGAGCGGCCGAGCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl