ARi57A02 NRCD Human cDNA Clone

Prev. | Human A to Z list > F > FLNC >

ARi57A02 - NRCD Human cDNA Clone


Catalog Number	HKR182802
Clone Name	ARi57A02
Clone info.	Plasmid clone of human FLNC cDNA with SV40 promoter
Vector Click for information	pGCAP10
5'-terminal sequence⁽¹⁾	ACTTCCCGAGCACCGCTCCGACCCTGGAGGGAGAGAGAGCCAGAGAGCGGCCGAGCGCCT
Sequence, submitted⁽²⁾	AB371585 [link]
Sequence, refered	NM_001458.4 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽³⁾	FLNC (NCBI Gene 2318) other clone of FLNC in our bank
Synonyms	ABP-280\|ABP280A\|ABPA\|ABPL\|CMH26\|FLN2\|MFM5\|MPD4\|RCM5
Protein Name	filamin C

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR182802	ARi57A02	DNA solution

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (by primer A)	Seq File (by primer B)	Seq File (by primer C)	Seq File (contig)	PDF File
ARi57A02a.seq		ARi57A02c.seq		ARi57A02.pdf