Prev. |  Human A to Z list >  F >  FLNC > 

ARi57A02 - NRCD Human cDNA Clone

Catalog Number HKR182802
Clone Name ARi57A02
Clone info. Plasmid clone of human FLNC cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) ACTTCCCGAGCACCGCTCCGACCCTGGAGGGAGAGAGAGCCAGAGAGCGGCCGAGCGCCT
Sequence, submitted(3) AB371585 [link]
Note Full cds when compared using AB371585
 
Sequence, refered NM_001458.5 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) FLNC (NCBI Gene 2318)  other clone of FLNC in our bank
Synonyms ABP-280|ABP280A|ABPA|ABPL|CMH26|FLN2|MFM5|MPD4|RCM5
Protein Name filamin C
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR182802 ARi57A02 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARi57A02 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR182802).

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARi57A02a.seq   ARi57A02c.seq   ARi57A02.pdf

References and tips

Featured content

Reference

user_report Reimann, L., Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C. Commun. Biol. 3 (1): 253 (2020). PMID 32444788.
user_report Kamil, M., High filamin-C expression predicts enhanced invasiveness and poor outcome in glioblastoma multiforme. Br. J. Cancer. 120 (8): 819-826 (2019). PMID 30867563.
user_report Duff, R.M., Mutations in the N-terminal actin-binding domain of filamin C cause a distal myopathy. Am. J. Hum. Genet. 88 (6): 729-740 (2011). PMID 21620354.

2023.07.07

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230707.pl