Prev. |  KEGG KO K04437 > 

RIKEN DNA Bank Human Resource - FLNB

Gene ID NCBI Gene 2317 |  KEGG hsa:2317
Gene Symbol FLNB
Protein Name filamin B
Synonyms ABP-278|ABP-280|AOI|FH1|FLN-B|FLN1L|LRS1|SCT|TABP|TAP
Ortholog resources KEGG ortholog (KEGG orthology K04437) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049276 ARe23D04 pKA1U5 NM_001457.2  
GAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCGCT
HKR070878 ARe77D06 pKA1U5 NM_001457.2  
GGCAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCG
HKR075681 ARe89D09 pKA1U5 NM_001457.2  
GAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCGCT
HKR164928 ARi12F08 pGCAP10 NM_001457.2  
GAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl