ARe77D06 NRCD Human cDNA Clone

Prev. | Human A to Z list > F > FLNB >

ARe77D06 - NRCD Human cDNA Clone


Catalog Number	HKR070878
Clone Name	ARe77D06
Clone info.	Plasmid clone of human FLNB cDNA with SV40 promoter
Vector⁽¹⁾	pKA1U5
5'-terminal sequence⁽²⁾	GGCAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCG
Sequence, submitted⁽³⁾	AB371580 [link]
Note	Full cds when compared using AB371580
Sequence, refered	NM_001164317.2 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	FLNB (NCBI Gene 2317) other clone of FLNB in our bank
Synonyms	ABP-278\|ABP-280\|AOI\|FH1\|FLN-B\|FLN1L\|LRS1\|SCT\|TABP\|TAP
Protein Name	filamin B

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR070878	ARe77D06	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe77D06 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR070878).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.