Prev. |  KEGG KO K09571 > 

RIKEN DNA Bank Human Resource - FKBP5

Gene ID NCBI Gene 2289 |  KEGG hsa:2289
Gene Symbol FKBP5
Protein Name FKBP prolyl isomerase 5
Synonyms AIG6|FKBP51|FKBP54|P54|PPIase|Ptg-10
Ortholog resources KEGG ortholog (KEGG orthology K09571) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR187372 ARi68H04 pGCAP10 NM_004117.2  
GGGGGCGGGACGGCGCCGGGCGCTGCCCCGGGGATTCGGGCCGGCTCGCGGGCGCTGCCA
HKR470929 RBdS177F09 pGCAP10 NM_004117.2 done
GGGGATTCGGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl