Prev. |  Human A to Z list >  F >  FKBP5 > 

RBdS177F09 - NRCD Human cDNA Clone

Catalog Number HKR470929
Clone Name RBdS177F09
Clone info. Plasmid clone of human FKBP5 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGGGATTCGGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCGCGGG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_004117.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) FKBP5 (NCBI Gene 2289)  other clone of FKBP5 in our bank
Synonyms AIG6|FKBP51|FKBP54|P54|PPIase|Ptg-10
Protein Name FKBP prolyl isomerase 5
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR470929 RBdS177F09 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS177F09 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR470929).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBdS177F09a.seq   RBdS177F09c.seq   RBdS177F09.pdf

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl