Prev. |  KEGG KO K10894 > 

RIKEN DNA Bank Human Resource - FANCG

Gene ID NCBI Gene 2189 |  KEGG hsa:2189
Gene Symbol FANCG
Protein Name FA complementation group G
Synonyms FAG|XRCC9
Ortholog resource in our bank

  FANCG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082860 IRAL007C12 pOTB7 BC000032 NM_004629 Full
HGY086140 IRAL015F20 pOTB7 BC011623 NM_004629 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008298 W01A020M10 pENTR-TOPO IRAL007C12 BC000032 NM_004629  
HGE008302 W01A020M14 pENTR-TOPO IRAL007C12 BC000032 NM_004629  
HGE038049 W01A095C01 pENTR-TOPO IRAL015F20 BC011623 NM_004629  
HGE038059 W01A095C11 pENTR-TOPO IRAL015F20 BC011623 NM_004629  
HGE038063 W01A095C15 pENTR-TOPO IRAL015F20 BC011623 NM_004629  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR406112 RBdS015E16 pGCAP10 NM_004629.1  
GCTGTCCTGGAAAGCCTGGGCGGGTGGATTGGGACCCCGAGAGAAGCAGGGGAGCTCGGC
HKR433571 RBdS083P11 pGCAP10 NM_004629.1  
GGGGGTGTGGCAGCGAGGAAGGGCCGAGCCACGGACTGTGGGGCCGAAACTCGCTCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl