Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015E16

Clone ID RBdS015E16
HP ID HP08892
Gene ID 2189
Gene Symbol FANCG
Protein Name Fanconi anemia, complementation group G
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004629.1
Length of RefSeq (bp) 2649
Chromosome 9p13
Reference DDBJ accession
UniGene Hs.591084
5'-terminal sequence GCTGTCCTGGAAAGCCTGGGCGGGTGGATTGGGACCCCGAGAGAAGCAGGGGAGCTCGGC
2011.08.28