Prev. |  KEGG KO K14563 > 

RIKEN DNA Bank Human Resource - FBL

Gene ID NCBI Gene 2091 |  KEGG hsa:2091
Gene Symbol FBL
Protein Name fibrillarin
Synonyms FIB|FLRN|Nop1|RNU3IP1
Ortholog resources KEGG ortholog (KEGG orthology K14563) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13368 pYNL-C1_fibrillarin Yellow Nano-lantern for labeling of nucleoli by the human fibrillarin.
RDB13369 pCNL-C1_fibrillarin Cyan Nano-lantern for labeling of nucleoli by the human fibrillarin.
RDB13370 pONL-C1_fibrillarin Orange Nano-lantern for labeling of nucleoli by the human fibrillarin.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008358 IRAK020O22 pCMV-SPORT6 BC015218 NM_001436 Partial
HGX011802 IRAK029I10 pCMV-SPORT6 BC019609 NM_001436 Partial
HGY082784 IRAL006P24 pOTB7 BC019260 NM_001436 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005794 W01A014I02 pENTR-TOPO IRAL006P24 BC019260 NM_001436  
HGE005796 W01A014I04 pENTR-TOPO IRAL006P24 BC019260 NM_001436  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046425 ARe16B01 pKA1U5 NM_001436.2  
GGTGCGAAAGCCCCGGACTCGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAAC
HKR072030 ARe80B06 pKA1U5 NM_001436.2  
ATCCTGGGCGGACTCCGGAGCCGCACAAACCAGGGCTCGCCATGAAGCCAGGATTCAGTC
HKR181683 ARi54D11 pGCAP10 NM_001436.2  
GACGTGCGAAAGCCCCGGACTCGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAA
HKR203406 ARiS008I14 pGCAP10 NM_001436.2  
TGCGGACTCGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAACCAGGGCTCGCC
HKR276624 ARiS191J08 pGCAP10 NM_001436.2  
GGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAACCAGGGCTCGCCATGAAGCC
HKR324148 RBb10G04 pKA1U5 NM_001436.2  
GACTCGCTGGAGTTGTGAACGCCGCGGACTCCGNATNCGCACAAACCAGGGCTCGCCATG
HKR336970 RBb42H02 pGCAP1 NM_001436.2  
GGTGCGAAAGCCCCGGACTCGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAAC
HKR380953 RBd52G09 pGCAP10 NM_001436.2  
GGTGCGAAAGCCCCGGACTCGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAAC
HKR444162 RBdS110G18 pGCAP10 NM_001436.2  
GGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAACCAGGGCTCGCCATGAAGCCAG
HKR474936 RBdS187F16 pGCAP10 NM_001436.2  
ACCGCATGCTCATCGCAATGGTGGATGTGATCTTTGCTGATGTGGCCCAGCCAGACCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.07.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl