Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110G18

Clone ID RBdS110G18
HP ID HP00513
Gene ID 2091
Gene Symbol FBL
Protein Name fibrillarin
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001436.2
Length of RefSeq (bp) 1135
Chromosome 19q13.1
Reference DDBJ accession
UniGene Hs.299002
5'-terminal sequence GGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAACCAGGGCTCGCCATGAAGCCAG
2011.08.28