Prev. | 

RIKEN DNA Bank Human Resource - ERCC5

Gene ID NCBI Gene 2073 |  KEGG hsa:2073
Gene Symbol ERCC5
Protein Name ERCC excision repair 5, endonuclease
Synonyms COFS3|ERCC5-201|ERCM2|UVDR|XPG|XPGC
Featured content DNA repair (human)
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005438 IRAK013J22 pCMV-SPORT6 BC031522 NM_000123 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020426 W01A051B02 pENTR-TOPO IRAK013J22 BC031522 NM_000123  
HGE020432 W01A051B08 pENTR-TOPO IRAK013J22 BC031522 NM_000123  
HGE020436 W01A051B12 pENTR-TOPO IRAK013J22 BC031522 NM_000123  
HGE020438 W01A051B14 pENTR-TOPO IRAK013J22 BC031522 NM_000123  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR367372 RBd18H04 pGCAP10 NM_000123.2  
GGAGACGTGTTGCAGCCAGAGTCTCTCCGCTTTAATGCGCTCCCATTAGTGCCGTCCCCC
HKR444359 RBdS110O23 pGCAP10 NM_000123.2  
GAGGGCGGTGACAGCTGCTGAGACGTGTTGCAGCCAGAGTCTCTCCGCTTTAATGCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl