Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110O23

Clone ID RBdS110O23
HP ID HP00613
Gene ID 2073
Gene Symbol ERCC5
Protein Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000123.2
Length of RefSeq (bp) 4100
Chromosome 13q33
Reference DDBJ accession
UniGene Hs.258429
5'-terminal sequence GAGGGCGGTGACAGCTGCTGAGACGTGTTGCAGCCAGAGTCTCTCCGCTTTAATGCGCTC
2011.08.28