Prev. |  KEGG KO K07205 > 

RIKEN DNA Bank Human Resource - EIF4EBP1

Gene ID NCBI Gene 1978 |  KEGG hsa:1978
Gene Symbol EIF4EBP1
Protein Name eukaryotic translation initiation factor 4E binding protein 1
Synonyms 4E-BP1|4EBP1|BP-1|PHAS-I
Ortholog resources KEGG ortholog (KEGG orthology K07205) in the DNA Bank
Featured content HIF-1 signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083853 IRAL009K13 pOTB7 BC004459 NM_004095 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059633 ARe49B09 pKA1U5 NM_004095.3  
GAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCCAT
HKR176570 ARi41H02 pGCAP10 NM_004095.3  
GGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAG
HKR235558 ARiS088O22 pGCAP10 NM_004095.3  
GGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCC
HKR322406 RBb06A06 pKA1U5 NM_004095.3  
GAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCCAT
HKR339780 RBb49H12 pGCAP1 NM_004095.3  
GAGAGGGCAGCGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTTCCGGGGGCAGCA
HKR374908 RBd37E12 pGCAP10 NM_004095.3  
GGGAGCGAGGCTGGAGGCGCGGGAGGGCAGCGAGAGGTTCGCGGGTGCAGCGCACAGGAG
HKR405663 RBdS014C15 pGCAP10 NM_004095.3  
TGGGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAA
HKR430209 RBdS075I17 pGCAP10 NM_004095.3  
GGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAG
HKR470874 RBdS177D02 pGCAP10 NM_004095.3  
GAGGGCAGCGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl