Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177D02

Clone ID RBdS177D02
HP ID HP01455
Gene ID 1978
Gene Symbol EIF4EBP1
Protein Name eukaryotic translation initiation factor 4E binding protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004095.3
Length of RefSeq (bp) 877
Chromosome 8p12
Reference DDBJ accession
UniGene Hs.411641
5'-terminal sequence GAGGGCAGCGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCT
2011.08.28