Prev. |  KEGG KO K04645 > 

RIKEN DNA Bank Human Resource - CLTB

Gene ID NCBI Gene 1212 |  KEGG hsa:1212
Gene Symbol CLTB
Protein Name clathrin light chain B
Synonyms LCB
Ortholog resources KEGG ortholog (KEGG orthology K04645) in the DNA Bank
Featured content Endocytosis (human)
Featured content Lysosome (human)
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083437 IRAL008J21 pOTB7 BC006457 NM_001834 Full
HGY087103 IRAL017M15 pOTB7 BC006332 NM_001834 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE106019 M01C065A19 pDONR221 06_07-A10 BC006332 NM_007097  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167702 ARi19E06 pGCAP10 NM_001834.2  
GGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAA
HKR248878 ARiS122D06 pGCAP10 NM_001834.2  
GAGTGACAGCCAGCCGGGCCCGGTGGCGGAGAGGAAGTGCGGTCCGCGCCAAGCCCGTCC
HKR337377 RBb43H09 pGCAP1 NM_001834.2  
GGCCGCGGCGCCCGCACCGCANTTGTACAGCCAGTCCGGGCCCGGTTGGCGGAGAGGAAG
HKR347281 RBb68D09 pGCAP1 NM_001834.2  
GCCGGCTCCGCTCCTCCCGCCGCGGCGCCCGCACCGCAGTGACAGCCAGCCGGGCCCGGT
HKR396953 RBd92G09 pGCAP10 NM_001834.2  
GGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAAGGCCAGAGTCA
HKR416208 RBdS040I16 pGCAP10 NM_001834.2  
GGCTGGCCCCGCCCCCTAGCGCCGCGGTCGGAGCCATTTCGCCGATTCCTCCATGCGAGT
HKR444017 RBdS110A17 pGCAP10 NM_001834.2  
GATTTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAAGG
HKR453020 RBdS132J04 pGCAP10 NM_001834.2  
GGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAA
HKR474868 RBdS187C20 pGCAP10 NM_001834.2  
GGCCGCGGCGCCCGCACCGCAGTGACAGCCAGCCGGGCCCGGTGGCGGAGAGGAAGTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl