Prev. |  KEGG KO K04645 > 

RIKEN DNA Bank Human Resource - CLTB

Gene ID NCBI Gene 1212 |  KEGG hsa:1212
Gene Symbol CLTB
Protein Name clathrin light chain B
Synonyms LCB
Featured content Endocytosis (human)
Featured content Lysosome (human)
Featured content Huntington disease - human
Ortholog resource in our bank

  CLTB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083437 IRAL008J21 pOTB7 BC006457 NM_001834 Full
HGY087103 IRAL017M15 pOTB7 BC006332 NM_001834 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167702 ARi19E06 pGCAP10 NM_001834.2  
GGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAA
HKR248878 ARiS122D06 pGCAP10 NM_001834.2  
GAGTGACAGCCAGCCGGGCCCGGTGGCGGAGAGGAAGTGCGGTCCGCGCCAAGCCCGTCC
HKR337377 RBb43H09 pGCAP1 NM_001834.2  
GGCCGCGGCGCCCGCACCGCANTTGTACAGCCAGTCCGGGCCCGGTTGGCGGAGAGGAAG
HKR347281 RBb68D09 pGCAP1 NM_001834.2  
GCCGGCTCCGCTCCTCCCGCCGCGGCGCCCGCACCGCAGTGACAGCCAGCCGGGCCCGGT
HKR396953 RBd92G09 pGCAP10 NM_001834.2  
GGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAAGGCCAGAGTCA
HKR416208 RBdS040I16 pGCAP10 NM_001834.2  
GGCTGGCCCCGCCCCCTAGCGCCGCGGTCGGAGCCATTTCGCCGATTCCTCCATGCGAGT
HKR444017 RBdS110A17 pGCAP10 NM_001834.2  
GATTTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAAGG
HKR453020 RBdS132J04 pGCAP10 NM_001834.2  
GGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAA
HKR474868 RBdS187C20 pGCAP10 NM_001834.2  
GGCCGCGGCGCCCGCACCGCAGTGACAGCCAGCCGGGCCCGGTGGCGGAGAGGAAGTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl