Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132J04

Clone ID RBdS132J04
HP ID HP01248
Gene ID 1212
Gene Symbol CLTB
Protein Name clathrin, light polypeptide (Lcb)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001834.2
Length of RefSeq (bp) 1130
Chromosome 5q35
Reference DDBJ accession
UniGene Hs.484241
5'-terminal sequence GGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAA
2011.08.28