Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP3S1

Gene ID (NCBI) 1176
Gene Symbol AP3S1
Protein Name adaptor-related protein complex 3, sigma 1 subunit
Synonyms CLAPS3|Sigma3A
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001847 IRAK004K07 pCMV-SPORT6 BC000804 NM_001002924 Partial
HGY087885 IRAL019L21 pDNR-LIB BC012614 NM_001002924 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053651 ARe34C03 pKA1U5 NM_001284.2  
GGGGGCGGGCTGGGGAAGGATCGCAGGCGAGATCCCTANGCGAGGCTCGCGCGCCCGCCC
HKR067304 ARe68E08 pKA1U5 NM_001284.2  
GGCCCGACGGCTCGGGAGCGCGCGCGGTCGCGCTGCGGGAGGGGGCGGGTGGGGAAGGAT
HKR371728 RBd29F08 pGCAP10 NM_001284.2  
GAGGGGGCGGGTGGGGAAGGATCGCAGGCGAGATTACGAGGCGAGGCTCGCGCGCCCGCC
HKR378475 RBd46D03 pGCAP10 NM_001284.2  
GAGGCGCCGGAGTAGGGGGACGCAATTACACAGTGAAACTTGGTGTTCCCGGCTAGTCAT
HKR340569 RBb51H01 pGCAP1 NM_001284.2  
GGCGGGTGGGGAAGGATCGCAGGCGAGATTACGAGGCGAGGCTCGCGCGCCCGCCCCCGC
HKR470932 RBdS177F12 pGCAP10 NM_001284.2  
GGTGCGGGAGGGGGCGGGTGGGGAAGGATCGCAGGCGAGATTACGAGGCGAGGCTCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl