Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177F12

Clone ID RBdS177F12
HP ID HP05093
Gene ID 1176
Gene Symbol AP3S1
Protein Name adaptor-related protein complex 3, sigma 1 subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001284.2
Length of RefSeq (bp) 1313
Chromosome 5q22
Reference DDBJ accession
UniGene Hs.718489
5'-terminal sequence GGTGCGGGAGGGGGCGGGTGGGGAAGGATCGCAGGCGAGATTACGAGGCGAGGCTCGCGC
2011.08.28