Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP2M1

Gene ID (NCBI) 1173
Gene Symbol AP2M1
Protein Name adaptor-related protein complex 2, mu 1 subunit
Synonyms AP50|CLAPM1|mu2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010512 IRAK026E16 pCMV-SPORT6 BC013796 NM_004068 Full/var
HGY083690 IRAL009D18 pOTB7 BC004996 NM_004068 Full
HGY091517 IRAL028N05 pOTB7 BC014030 NM_004068 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040854 ARe02C06 pKA1U5 NM_004068.3  
GGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCGAGGACA
HKR041675 ARe04D03 pKA1U5 NM_004068.3  
GAGCCGAGGCAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTG
HKR042876 ARe07D04 pKA1U5 NM_004068.3  
GGAAAGCCGAGGCAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGA
HKR043226 ARe08B02 pKA1U5 NM_004068.3  
GAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCG
HKR081773 ARf04H05 pKA1U5 NM_004068.3  
GGAGGCAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCG
HKR163632 ARi09B08 pGCAP10 NM_004068.3  
GAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGC
HKR048852 ARe22C04 pKA1U5 NM_004068.3  
TGATGACTGCGGTGAAAGCCGAGGCAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTT
HKR168852 ARi22C04 pGCAP10 NM_004068.3  
GGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCGAGGACACC
HKR052450 ARe31C02 pKA1U5 NM_004068.3  
GGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCGAGGACACCAG
HKR053278 ARe33D06 pKA1U5 NM_004068.3  
GCGGAGACGAGCANGGGGCGGGCGGACATCTTGNGATCCGGAGAGTGGCCGGGCCGGCAG
HKR175653 ARi39C05 pGCAP10 NM_004068.3  
GGGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCC
HKR176829 ARi42B05 pGCAP10 NM_004068.3  
GGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCGAGGACA
HKR183677 ARi59D05 pGCAP10 NM_004068.3  
TTTTGAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCA
HKR066408 ARe66A08 pKA1U5 NM_004068.3  
GAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGC
HKR078149 ARe95G05 pKA1U5 NM_004068.3  
GAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCC
HKR203331 ARiS008F11 pGCAP10 NM_004068.3  
GACTGCGGTGAAAGCCGAGGCAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGA
HKR209438 ARiS023J22 pGCAP10 NM_004068.3  
GAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGC
HKR260356 ARiS150O20 pGCAP10 NM_004068.3  
GGAAAGCCGAGGCAGCGGGCANACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGA
HKR276572 ARiS191H04 pGCAP10 NM_004068.3  
GGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCGAGGA
HKR277901 ARiS194M13 pGCAP10 NM_004068.3  
GGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCG
HKR365206 RBd13A06 pGCAP10 NM_004068.3  
GAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGC
HKR366035 RBd15B11 pGCAP10 NM_004068.3  
GGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCCGAGGACA
HKR370809 RBd27A09 pGCAP10 NM_004068.3  
GGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGG
HKR372576 RBd31H08 pGCAP10 NM_004068.3  
GAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCC
HKR375329 RBd38F09 pGCAP10 NM_004068.3  
GACTGCGGTGAAAGCCGAGGCAGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGA
HKR384131 RBd60F11 pGCAP10 NM_004068.3  
GGGGGGCGGGGCGGCGGCACTGCGGTGAAAGCCGAGGCAGCGGGCAGACGAGCAGGGGGC
HKR387707 RBd69E11 pGCAP10 NM_004068.3  
GGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCA
HKR348155 RBb70G11 pGCAP1 NM_004068.3  
AGCGGGCAGACGAGCAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGG
HKR416189 RBdS040H21 pGCAP10 NM_004068.3  
GAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCC
HKR416256 RBdS040K16 pGCAP10 NM_004068.3  
GAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl