Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040K16

Clone ID RBdS040K16
HP ID HP00471
Gene ID 1173
Gene Symbol AP2M1
Protein Name adaptor-related protein complex 2, mu 1 subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004068.3
Length of RefSeq (bp) 1958
Chromosome 3q28
Reference DDBJ accession
UniGene Hs.518460
5'-terminal sequence GAGGGGGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGGCCGGCAGAGCAGGGGGCC
2011.08.28