Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - ERCC8

Gene ID (NCBI) 1161
Gene Symbol ERCC8
Protein Name excision repair cross-complementing rodent repair deficiency, complementation group 8
Synonyms CKN1|CSA|UVSS2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10570)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087604 IRAL019A04 pDNR-LIB BC009793 NM_001007234 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038639 W01A096J23 pENTR-TOPO IRAL019A04 BC009793 NM_001007234  
HGE038669 W01A096L05 pENTR-TOPO IRAL019A04 BC009793 NM_001007234  
HGE047636 W01A119B12 pENTR-TOPO IRAL019A04 BC009793 NM_001007234  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR346076 RBb65D04 pGCAP1 NM_000082.3  
GGCCCCTGAGCTCTGTCATGGCGACGTCCAGTGCTCCAGCCGGTGTGAGGACACGATATG
HKR405542 RBdS013O06 pGCAP10 NM_000082.3  
GCCCTGAGCTCTGTCATGGCGACGTCCAGTGCTCCAGCCGGTGTGAGGACACGATATGCT
HKR475008 RBdS187I16 pGCAP10 NM_000082.3  
GAGTCCCGCCCCTGAGCTCTGTCATGGCGACGTCCAGTGCTCCAGCCGGTGTGAGGACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl