Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187I16

Clone ID RBdS187I16
HP ID HP06561
Gene ID 1161
Gene Symbol ERCC8
Protein Name excision repair cross-complementing rodent repair deficiency, complementation group 8
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000082.3
Length of RefSeq (bp) 2044
Chromosome 5q12.1
Reference DDBJ accession
UniGene Hs.435237
5'-terminal sequence GAGTCCCGCCCCTGAGCTCTGTCATGGCGACGTCCAGTGCTCCAGCCGGTGTGAGGACAC
2011.08.28