Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CKB

Gene ID (NCBI) 1152
Gene Symbol CKB
Protein Name creatine kinase, brain
Synonyms B-CK|BCK|CKBB|HEL-S-29
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082629 IRAL006J13 pOTB7 BC001190 NM_001823 Full
HGY082678 IRAL006L14 pOTB7 BC019259 NM_001823 Full
HGY083802 IRAL009I10 pOTB7 BC019281 NM_001823 Full
HGY084652 IRAL011K12 pOTB7 BC004914 NM_001823 Full
HGY089245 IRAL023B21 pOTB7 BC008323 NM_001823 Full
HGY090676 IRAL026L12 pOTB7 BC010002 NM_001823 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR325627 RBb14B03 pKA1U5 NM_001823.3  
TGGGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCTN
HKR365207 RBd13A07 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR366859 RBd17C11 pGCAP10 NM_001823.3  
GTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGG
HKR328525 RBb21F05 pKA1U5 NM_001823.3  
GTTGGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCG
HKR368081 RBd20D09 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR368570 RBd21H02 pGCAP10 NM_001823.3  
GTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGG
HKR370175 RBd25H07 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR332569 RBb31H01 pGCAP1 NM_001823.3  
HKR333352 RBb33G08 pGCAP1 NM_001823.3  
HKR335281 RBb38D09 pGCAP1 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR375326 RBd38F06 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR339753 RBb49G09 pGCAP1 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR340155 RBb50G11 pGCAP1 NM_001823.3  
GGTTCGCCTGCGNTCGCTCCGGGTAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCG
HKR380901 RBd52E05 pGCAP10 NM_001823.3  
GGGGTCAGTGTCACCTCCAGGATACAGACAGCCCCCCTTCAGCCCAGCCCAGCCAGGTCT
HKR382503 RBd56E07 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGNNNNNNNNNNCCCGCCCGGC
HKR382903 RBd57E07 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC
HKR382976 RBd57H08 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGANNNNNNNNNNNNCCGCCCGGC
HKR345697 RBb64E01 pGCAP1 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC
HKR387682 RBd69D10 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR348169 RBb70H01 pGCAP1 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR391755 RBd79G11 pGCAP10 NM_001823.3  
GNTTGTTCCCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCCCCCCCCNCC
HKR394427 RBd86B03 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC
HKR396425 RBd91B01 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR399611 RBd99A11 pGCAP10 NM_001823.3  
TGTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCG
HKR402989 RBdS007H21 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC
HKR405706 RBdS014E10 pGCAP10 NM_001823.3  
HKR420619 RBdS051J03 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR430167 RBdS075G23 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC
HKR432671 RBdS081L07 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGNNNNNNCNT
HKR441960 RBdS104O24 pGCAP10 NM_001823.3  
GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
HKR441967 RBdS104P07 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC
HKR471101 RBdS177M13 pGCAP10 NM_001823.3  
GGCTGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl