Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104O24

Clone ID RBdS104O24
HP ID HP00291
Gene ID 1152
Gene Symbol CKB
Protein Name Creatine kinase, brain
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001823.3
Length of RefSeq (bp) 1431
Chromosome 14q32
Reference DDBJ accession
UniGene Hs.173724
5'-terminal sequence GGTTCGCCTGCGTCGCTCCGGGAGCTGCCGACGGACGGAGCGCCCCCGCCCCCGCCCGGC
2011.08.28