Prev. |  KEGG KO K03363 > 

RIKEN DNA Bank Human Resource - CDC20

Gene ID NCBI Gene 991 |  KEGG hsa:991
Gene Symbol CDC20
Protein Name cell division cycle 20
Synonyms CDC20A|bA276H19.3|p55CDC
Ortholog resource in our bank

  CDC20

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080862 IRAL002C14 pOTB7 BC012803 NM_001255 Full/var
HGY080894 IRAL002D22 pOTB7 BC001088 NM_001255
HGY082348 IRAL005O12 pOTB7 BC000624 NM_001255 Full/var
HGY084101 IRAL010E05 pOTB7 BC013303 NM_001255 Full/var
HGY084143 IRAL010F23 pOTB7 BC012827 NM_001255 Full/var
HGY086373 IRAL015P13 pOTB7 BC006272 NM_001255 Full/var
HGY088836 IRAL022B12 pOTB7 BC009426 NM_001255 Full/var
HGY088837 IRAL022B13 pOTB7 BC009426 NM_001255 Full/var
HGY088840 IRAL022B16 pOTB7 BC031294 NM_001255 Full/var
HGY088841 IRAL022B17 pOTB7 BC024257 NM_001255 Full/var
HGY088842 IRAL022B18 pOTB7 BC009425 NM_001255 Full/var
HGY090959 IRAL027G15 pOTB7 BC010044 NM_001255 Full/var
HGY095262 IRAL038C14 pDNR-LIB BC015998 NM_001255 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170508 ARi26E12 pGCAP10 NM_001255.2  
GGGTCGGAACTGCTCCGGAGGGCACGGGCTCCGTAGGCACCAACTGCAAGGACCCCTCCC
HKR175632 ARi39B08 pGCAP10 NM_001255.2  
GGGTCGGAACTGCTCCGGAGGGCACGGGCTCCGTAGGCACCAACTGCAAGGACCCCTCCC
HKR247311 ARiS118E15 pGCAP10 NM_001255.2  
GGGTCGGAACTGCTCCGGAGGGCACGGGCTCCGTAGGCACCAACTGCAAGGACCCCTCCC
HKR248920 ARiS122E24 pGCAP10 NM_001255.2  
GGGTCGGAACTGCTCCGGAGGGCACGGGCTCCGTAGGCACCAACTGCAAGGACCCCTCCC
HKR406171 RBdS015H03 pGCAP10 NM_001255.2  
CGGCCGGCCGATGGGGCGTAAGCCAGGCGTGTTAAAGCCGGTCGGAACTGCTCCGGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl