Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015H03

Clone ID RBdS015H03
HP ID HP07392
Gene ID 991
Gene Symbol CDC20
Protein Name cell division cycle 20 homolog (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001255.2
Length of RefSeq (bp) 1697
Chromosome 1p34.1
Reference DDBJ accession
UniGene Hs.524947
5'-terminal sequence CGGCCGGCCGATGGGGCGTAAGCCAGGCGTGTTAAAGCCGGTCGGAACTGCTCCGGAGGG
2011.08.28