Prev. |  KEGG KO K06256 > 

RIKEN DNA Bank Human Resource - CD44

Gene ID NCBI Gene 960 |  KEGG hsa:960
Gene Symbol CD44
Protein Name CD44 molecule (Indian blood group)
Synonyms CDW44|CSPG8|ECMR-III|HCELL|HUTCH-I|IN|LHR|MC56|MDU2|MDU3|MIC4|Pgp1
Ortholog resource in our bank

  CD44

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04668 pAxCALNLhCD44(reverse) Shuttle vector to generate rAd expressing human CD44
RDB04674 pAxCALNLhCD44(forward) Shuttle vector to generate rAd expressing human CD44
RDB04683 pAxCALNLhCD44(reverse) Shuttle vector to generate rAd expressing human CD44
RDB04684 pAxCALNLhCD44(forward) Shuttle vector to generate rAd expressing human CD44
RDB05149 pAxCALNLhCD44 (forward) Shuttle vector to generate rAd harboring human CD44 (forward)
RDB05150 pAxCALNLhCD44 (reverse) Shuttle vector to generate rAd harboring human CD44 (reverse)
RDB07582 pTarget-hCD44
RDB07685 pGL4-phCD44 Promoter collection, Human CD44 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085570 IRAL013P10 pOTB7 BC004372 NM_001001389 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025948 W01A064O12 pENTR-TOPO IRAL013P10 BC004372 NM_001001389  
HGE025952 W01A064O16 pENTR-TOPO IRAL013P10 BC004372 NM_001001389  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046473 ARe16D01 pKA1U5 NM_000610.3 done
GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCC
HKR047307 ARe18E11 pKA1U5 NM_000610.3 done
TAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGC
HKR047627 ARe19B03 pKA1U5 NM_000610.3 done
GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGNTTCGGTCCGCCATCCTCGTCCCGTC
HKR164411 ARi11A11 pGCAP10 NM_000610.3 done
GCTCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGT
HKR171634 ARi29B10 pGCAP10 NM_000610.3 done
TGTGGCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCC
HKR174851 ARi37C03 pGCAP10 NM_000610.3 done
GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl