RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CD44

Gene ID	NCBI Gene 960 \| KEGG hsa:960
Gene Symbol	CD44
Protein Name	CD44 molecule (Indian blood group)
Synonyms	CDW44\|CSPG8\|ECM-III\|ECMR-III\|H-CAM\|HCELL\|HUTCH-1\|HUTCH-I\|Hermes-1\|IN\|LHR\|MC56\|MDU2\|MDU3\|MIC4\|Pgp1

Ortholog resource in our bank

  CD44

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB04668	pAxCALNLhCD44(reverse)	Shuttle vector to generate rAd expressing human CD44
RDB04674	pAxCALNLhCD44(forward)	Shuttle vector to generate rAd expressing human CD44
RDB04683	pAxCALNLhCD44(reverse)	Shuttle vector to generate rAd expressing human CD44
RDB04684	pAxCALNLhCD44(forward)	Shuttle vector to generate rAd expressing human CD44
RDB05149	pAxCALNLhCD44 (forward)	Shuttle vector to generate rAd harboring human CD44 (forward)
RDB05150	pAxCALNLhCD44 (reverse)	Shuttle vector to generate rAd harboring human CD44 (reverse)
RDB07582	pTarget-hCD44
RDB07685	pGL4-phCD44	Promoter collection, Human CD44 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY085570	IRAL013P10	pOTB7	BC004372	NM_001001389	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number	Clone name	Vector	Constructed from⁽¹⁾		CDS comparison		Status
Catalog number	Clone name	Vector	Clone ID	Sequence (DDBJ)	Refered mRNA	CDS status	Status
HGE025948	W01A064O12	pENTR-TOPO	IRAL013P10	BC004372	NM_001001389.2	full/var
HGE025952	W01A064O16	pENTR-TOPO	IRAL013P10	BC004372	NM_001001389

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR046473	ARe16D01	pKA1U5	NM_000610.3
HKR046473	GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCC
HKR047307	ARe18E11	pKA1U5	NM_000610.3
HKR047307	TAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGC
HKR047627	ARe19B03	pKA1U5	NM_000610.3
HKR047627	GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGNTTCGGTCCGCCATCCTCGTCCCGTC
HKR164411	ARi11A11	pGCAP10	NM_000610.3
HKR164411	GCTCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGT
HKR171634	ARi29B10	pGCAP10	NM_000610.3
HKR171634	TGTGGCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCC
HKR174851	ARi37C03	pGCAP10	NM_000610.3
HKR174851	GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl