Prev. |  Human A to Z list >  C >  CD44 > 

ARe19B03 - NRCD Human cDNA Clone

Catalog Number HKR047627
Clone Name ARe19B03
Clone info. Plasmid clone of human CD44 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGNTTCGGTCCGCCATCCTCGTCCCGTC
Sequence, submitted(2) n.a.
Note Another variant of NM_000610.3 (see data).
 
Sequence, refered NM_000610.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CD44 (NCBI Gene 960)  other clone of CD44 in our bank
Synonyms CDW44|CSPG8|ECMR-III|HCELL|HUTCH-I|IN|LHR|MC56|MDU2|MDU3|MIC4|Pgp1
Protein Name CD44 molecule (Indian blood group)
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR047627 ARe19B03 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe19B03a.seq   ARe19B03c.seq   ARe19B03.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_AR_210404.csv - GNP_filter3_NRCD_html_190131.pl