Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CAPZA1

Gene ID (NCBI) 829
Gene Symbol CAPZA1
Protein Name capping actin protein of muscle Z-line alpha subunit 1
Synonyms CAPPA1|CAPZ|CAZ1
Databases KEGG hsa:829 |  NCBI Gene 829
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10364)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001285 IRAK003D13 pCMV-SPORT6 BC000144 NM_006135 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR192425 ARi81B01 pGCAP10 NM_006135.2  
TAGAACAGCCCAAGATGGCCGACTTCGATGATCGTGTGTCGGATGAGGAGAAGGTACGCA
HKR433323 RBdS083F03 pGCAP10 NM_006135.2  
GGCCAGAACAGCCCAAGATGGCCGACTTCGATGATCGTGTGTCGGATGAGGAGAAGGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl