Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083F03

Clone ID RBdS083F03
HP ID HP02042
Gene ID 829
Gene Symbol CAPZA1
Protein Name capping protein (actin filament) muscle Z-line, alpha 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006135.2
Length of RefSeq (bp) 2758
Chromosome 1p13.2
Reference DDBJ accession
UniGene Hs.514934
5'-terminal sequence GGCCAGAACAGCCCAAGATGGCCGACTTCGATGATCGTGTGTCGGATGAGGAGAAGGTAC
2011.08.28