Prev. |  KEGG KO K08057 > 

RIKEN DNA Bank Human Resource - CALR

Gene ID NCBI Gene 811 |  KEGG hsa:811
Gene Symbol CALR
Protein Name calreticulin
Synonyms CRT|HEL-S-99n|RO|SSA|cC1qR
Ortholog resources KEGG ortholog (KEGG orthology K08057) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005855 IRAK014K15 pCMV-SPORT6 BC020493 NM_004343 Full
HGY081747 IRAL004G03 pOTB7 BC002500 NM_004343 Full
HGY088277 IRAL020L13 pOTB7 BC007911 NM_004343 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE034076 W01A085D04 pENTR-TOPO IRAK014K15 BC020493 NM_004343  
HGE034082 W01A085D10 pENTR-TOPO IRAK014K15 BC020493 NM_004343  
HGE034088 W01A085D16 pENTR-TOPO IRAK014K15 BC020493 NM_004343 done
HGE034090 W01A085D18 pENTR-TOPO IRAK014K15 BC020493 NM_004343  
HGE034092 W01A085D20 pENTR-TOPO IRAK014K15 BC020493 NM_004343  
HGE001831 W01A004J15 pENTR-TOPO IRAL020L13 BC007911 NM_004343  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044977 ARe12H09 pKA1U5 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR071677 ARe79D05 pKA1U5 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTTAAAGGGCCCGCGCGGTTGCCGC
HKR074148 ARe85G04 pKA1U5 NM_004343.3  
CAGAATACAACATCATGTTTGGTCCCGACATCTGTGGCCCTGGCACCAAGAAGGTTCATG
HKR078854 ARe97C06 pKA1U5 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR165705 ARi14E09 pGCAP10 NM_004343.3  
TGGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCC
HKR209553 ARiS023O17 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR219799 ARiS049I07 pGCAP10 NM_004343.3  
GGTCCGTACTGCANAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR234899 ARiS087E03 pGCAP10 NM_004343.3  
HKR243749 ARiS109G05 pGCAP10 NM_004343.3  
GGTCCGNCNCTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCC
HKR260257 ARiS150K17 pGCAP10 NM_004343.3  
TGGTCCGTACTGCAGAGCCNCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCC
HKR264683 ARiS161L19 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR374150 RBd35G06 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR377353 RBd43G09 pGCAP10 NM_004343.3  
GCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCCCC
HKR381654 RBd54C06 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR391228 RBd78B04 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR392430 RBd81B06 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR392431 RBd81B07 pGCAP10 NM_004343.3  
GGTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCC
HKR441707 RBdS104E11 pGCAP10 NM_004343.3  
GGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCCCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl