Prev. |  KEGG KO K02183 > 

RIKEN DNA Bank Human Resource - CALM3

Gene ID NCBI Gene 808 |  KEGG hsa:808
Gene Symbol CALM3
Protein Name calmodulin 3
Synonyms CaM|CaMIII|HEL-S-72|PHKD|PHKD3
Ortholog resources KEGG ortholog (KEGG orthology K02183) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082965 IRAL007G21 pOTB7 BC005137 NM_005184 Full
HGY083205 IRAL008A05 pOTB7 BC006182 NM_005184 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056810 ARe42A10 pKA1U5 NM_005184.2  
TGGAGGGACCGTTGGGGCGGGAGGCGGCGGCGGCGGCGGCGCGCGCTGCGGGCAGTGAGT
HKR208005 ARiS020A05 pGCAP10 NM_005184.2  
TGGGGGCGCGCGCGGCGGCCGTTGAGGGACCGTTGGGGCGGGAGGCGGCGGCGGCAANAN
HKR218014 ARiS045A14 pGCAP10 NM_005184.2  
GGGAACTGCTGCAGCTGCTGCCGCCGCCGGAGGAACCTTGATCCCCGTGCTCCGGACACC
HKR234327 ARiS085N15 pGCAP10 NM_005184.2  
GGTGGAGGCGCGGACGCGCGGCGGAGCTGGAACTGCTGCAGCTGCTGCCGCCGCCGGAGG
HKR333278 RBb33D06 pGCAP1 NM_005184.2  
GTGTTGGGTGTGGAGGCGCGGACGCGCGGCGGAGCTGGAACTGCTGCAGCTGCTGCCGCC
HKR368431 RBd21B07 pGCAP10 NM_005184.2  
GGAGCGAGGCGGGGCGCGCGCGGCGGCCGTTGAGGGACCGTTGGGGCGGGAGGCGGCGGC
HKR371778 RBd29H10 pGCAP10 NM_005184.2  
GGGGGCGGGAGGCGGCGGCGGCGGCGGCGCGCGCTGCGGGCAGTGAGTGTGGAGGCGCGG
HKR387278 RBd68D06 pGCAP10 NM_005184.2  
GGAGCCNGGCGGGGCGCGCGCGNNNNNCGTTGAGGGACCGTTGGNGNGGGAGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl