Prev. |  KEGG KO K02183 > 

RIKEN DNA Bank Human Resource - CALM2

Gene ID NCBI Gene 805 |  KEGG hsa:805
Gene Symbol CALM2
Protein Name calmodulin 2
Synonyms CAMII|LQT15|PHKD|PHKD2|caM
Ortholog resources KEGG ortholog (KEGG orthology K02183) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001205 IRAK003A05 pCMV-SPORT6 BC003354 NM_001743 Full
HGY083535 IRAL008N23 pOTB7 BC006464 NM_001743 Full
HGY088425 IRAL021B01 pDNR-LIB BC008437 NM_001743 Full/var
HGY092411 IRAL031A11 pDNR-LIB BC017385 NM_001743 Full
HGY092441 IRAL031B17 pDNR-LIB BC026065 NM_001743 Full
HGY095335 IRAL038F15 pDNR-LIB BC018677 NM_001743 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042955 ARe07G11 pKA1U5 NM_001743.4  
ATCCTGGAGTCCGAGTGGAGAGAGCGAGCTGANTGNTTGTGTGGTCGCGTCTCGGAAACC
HKR052877 ARe32D05 pKA1U5 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR069698 ARe74E02 pKA1U5 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR072004 ARe80A04 pKA1U5 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR074552 ARe86G08 pKA1U5 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR163772 ARi09H04 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR166550 ARi16G06 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR166571 ARi16H03 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR167373 ARi18H05 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR168408 ARi21A08 pGCAP10 NM_001743.4  
GAGTCCGACTGGANAGAGCGAGCTGAGTGATAGTGTGGTCGCGTCTCGGAAACCGGTCCG
HKR168803 ARi22A03 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR170527 ARi26F07 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR179376 ARi48H08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR182436 ARi56B12 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR182449 ARi56C01 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR185201 ARi63A01 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR185777 ARi64H09 pGCAP10 NM_001743.4  
HKR186900 ARi67E04 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR209471 ARiS023L07 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR219850 ARiS049K10 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR234306 ARiS085M18 pGCAP10 NM_001743.4  
GATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGT
HKR234837 ARiS087B13 pGCAP10 NM_001743.4  
GAGTCCNAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCNCGTCTCGGAAACCGGTAGC
HKR235496 ARiS088M08 pGCAP10 NM_001743.4  
GGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGCG
HKR238528 ARiS096F08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR243965 ARiS109P05 pGCAP10 NM_001743.4  
CGGCCGGCCGATGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCG
HKR247522 ARiS118N10 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCNAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR247580 ARiS118P20 pGCAP10 NM_001743.4  
CGGCCGGCCGATGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCG
HKR260058 ARiS150C10 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR279217 ARiS198A17 pGCAP10 NM_001743.4  
CGAGTCCGAGNGGAGAGAGCGAGCNGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAG
HKR324126 RBb10F06 pKA1U5 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR324956 RBb12G12 pKA1U5 NM_001743.4  
TGATTTTAGTCCGAGTGGAGAGAGCGAGCTGAGCTGGTTGTGTGGTCGCGTCTCGGAAAC
HKR329377 RBb23H09 pGCAP1 NM_001743.4  
HKR329657 RBb24C09 pGCAP1 NM_001743.4  
AGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAG
HKR330502 RBb26E06 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR332550 RBb31G06 pGCAP1 NM_001743.4  
TGTGTGGTCGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGCTGACCAACTGACTGAAG
HKR333702 RBb34E06 pGCAP1 NM_001743.4  
TGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAG
HKR334484 RBb36D12 pGCAP1 NM_001743.4  
TGGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTA
HKR334853 RBb37C05 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR339231 RBb48B07 pGCAP1 NM_001743.4  
ATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTA
HKR339604 RBb49A04 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR340102 RBb50E06 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR342810 RBb57A10 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR344526 RBb61F06 pGCAP1 NM_001743.4  
AAATGTGGGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCG
HKR345728 RBb64F08 pGCAP1 NM_001743.4  
TTTTGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGG
HKR346172 RBb65H04 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR346547 RBb66G03 pGCAP1 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR366173 RBd15H05 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR375346 RBd38G02 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR376900 RBd42E04 pGCAP10 NM_001743.4  
GATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGT
HKR376903 RBd42E07 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR377659 RBd44C11 pGCAP10 NM_001743.4  
GGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGCTGACCAACTGACT
HKR378003 RBd45A03 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR379209 RBd48A09 pGCAP10 NM_001743.4  
TGGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACC
HKR379608 RBd49A08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR380973 RBd52H05 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR381325 RBd53F05 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR381633 RBd54B09 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR382028 RBd55B04 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR382154 RBd55G10 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGNNNNNCGGAAACCGGTAGC
HKR382802 RBd57A02 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR382882 RBd57D10 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTNTCGGAAACCGGTAGC
HKR386405 RBd66A05 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR387632 RBd69B08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR387676 RBd69D04 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR389697 RBd74E01 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR391673 RBd79D01 pGCAP10 NM_001743.4  
GGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGCTGACCAACTGACTGAAGAGCAGATT
HKR392008 RBd80A08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR392425 RBd81B01 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR392572 RBd81H04 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR392856 RBd82C08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR394830 RBd87B06 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR394881 RBd87D09 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR396105 RBd90E09 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR396972 RBd92H04 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR398577 RBd96H09 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR398931 RBd97F11 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR402917 RBdS007E21 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR405942 RBdS014O06 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR406379 RBdS015P19 pGCAP10 NM_001743.4  
TGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAG
HKR408801 RBdS022A01 pGCAP10 NM_001743.4  
AATTGGGTTAAGGAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCG
HKR409099 RBdS022M11 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR416178 RBdS040H10 pGCAP10 NM_001743.4  
GGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGTTAGCTTTGTACATAGCATCTCACTT
HKR420443 RBdS051B19 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR428032 RBdS070B08 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR432512 RBdS081E16 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR433252 RBdS083C04 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR452811 RBdS132A11 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR470941 RBdS177F21 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR474844 RBdS187B20 pGCAP10 NM_001743.4  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCG
HKR474867 RBdS187C19 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR474911 RBdS187E15 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR474990 RBdS187H22 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC
HKR475047 RBdS187K07 pGCAP10 NM_001743.4  
GAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl