Prev. |  KEGG KO K02183 > 

RIKEN DNA Bank Human Resource - CALM1

Gene ID NCBI Gene 801 |  KEGG hsa:801
Gene Symbol CALM1
Protein Name calmodulin 1
Synonyms CALML2|CAMI|CPVT4|DD132|LQT14|PHKD|caM
Ortholog resources KEGG ortholog (KEGG orthology K02183) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007863 IRAK019K23 pCMV-SPORT6 BC008597 NM_006888 Full
HGY013159 IRAK032O23 pBluescriptR BC047523 NM_006888 Full
HGY036682 IRAK091L18 pBluescript BC042831 NM_006888
HGY080539 IRAL001F19 pOTB7 BC000454 NM_006888 Full
HGY088368 IRAL020P08 pOTB7 BC007965 NM_006888 Partial
HGY091355 IRAL028G11 pOTB7 BC011834 NM_006888 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045356 ARe13G12 pKA1U5 NM_006888.3  
GAGTGGTGCTGGGAGTGTCGTGGACGCCGTGCCGTTACTCGTAGTCAGGCGGCGGCGCAG
HKR047275 ARe18D03 pKA1U5 NM_006888.3  
GAGTGGTGCTGGGAGTGTCGTGGACGCCGATGCCGCTTACTCGTAGTCAGGCGGCGGCGC
HKR169251 ARi23C03 pGCAP10 NM_006888.3  
GGGCAGTGGTGCTGGGAGTGTCGTGGACGCCGTGCCGTTACTCGTAGTCAGGCGGCGGCG
HKR185703 ARi64E07 pGCAP10 NM_006888.3  
HKR362979 RBd07H11 pGCAP10 NM_006888.3  
GTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAG
HKR364860 RBd12C12 pGCAP10 NM_006888.3  
GGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGANCCGG
HKR395254 RBd88C06 pGCAP10 NM_006888.3  
GGGCAGTGGTGCTGGGAGTGTCGTGGACGCCGTGCCGTTACTCGTAGTCAGGCGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl