Prev. |  KEGG KO K11540 > 

RIKEN DNA Bank Human Resource - CAD

Gene ID NCBI Gene 790 |  KEGG hsa:790
Gene Symbol CAD
Protein Name carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms CDG1Z|EIEE50|GATD4
Ortholog resource in our bank

  CAD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092250 IRAL030K10 pOTB7 BC014178 NM_004341 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081201 M01C003A01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081249 M01C003C01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081297 M01C003E01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081345 M01C003G01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081393 M01C003I01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081441 M01C003K01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081489 M01C003M01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE081537 M01C003O01 pDONR221 04-134-2_2-A01 BC065510 ENST00000380093  
HGE110404 M01C076A04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110452 M01C076C04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110500 M01C076E04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110548 M01C076G04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110596 M01C076I04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110644 M01C076K04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110692 M01C076M04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE110740 M01C076O04 pDONR221 06-2_01-F02 BC065510 ENST00000380093  
HGE096011 M01C040A11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096059 M01C040C11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096107 M01C040E11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096155 M01C040G11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096203 M01C040I11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096251 M01C040K11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096299 M01C040M11 pDONR221 MGC09-E06 BC065510 ENST00000380093  
HGE096347 M01C040O11 pDONR221 MGC09-E06 BC065510 ENST00000380093  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR406062 RBdS015C14 pGCAP10 NM_004341.3  
GGCCGTCCTCACGTGGTTCCAGTGGAGTTTGCAGTCCTTCCCGCTTCTCCGTACTCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl