Prev. |  Human A to Z list >  C >  CAD > 

RBdS015C14 - NRCD Human cDNA Clone

Catalog Number HKR406062
Clone Name RBdS015C14
Clone info. Plasmid clone of human CAD cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGCCGTCCTCACGTGGTTCCAGTGGAGTTTGCAGTCCTTCCCGCTTCTCCGTACTCGCCC
Sequence, submitted(3) AB621827 [link]
 
Sequence, refered NM_004341.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) CAD (NCBI Gene 790)  other clone of CAD in our bank
Synonyms CDG1Z|EIEE50|GATD4
Protein Name carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR406062 RBdS015C14 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS015C14 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR406062).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl