Prev. |  KEGG KO K02178 > 

RIKEN DNA Bank Human Resource - BUB1

Gene ID NCBI Gene 699 |  KEGG hsa:699
Gene Symbol BUB1
Protein Name BUB1 mitotic checkpoint serine/threonine kinase
Synonyms BUB1A|BUB1L|hBUB1
Ortholog resource in our bank

  BUB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188524 ARi71F04 pGCAP10 NM_004336.3  
GATTCGAATCGGCGGCGGCTTCTAGTTTGCGGTTCAGGTTTGGCCGCTGCCGGCCAGCGT
HKR462652 RBdS156K12 pGCAP10 NM_004336.3  
GTGAGGTTTGGCCGCTGCCGGCCAGCGTCCTCTGGCCATGGACACCCCGGAAAATGTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl