Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156K12

Clone ID RBdS156K12
HP ID HP07691
Gene ID 699
Gene Symbol BUB1
Protein Name budding uninhibited by benzimidazoles 1 homolog (yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004336.3
Length of RefSeq (bp) 3509
Chromosome 2q14
Reference DDBJ accession
UniGene Hs.469649
5'-terminal sequence GTGAGGTTTGGCCGCTGCCGGCCAGCGTCCTCTGGCCATGGACACCCCGGAAAATGTCCT
2011.08.28