Prev. |  KEGG KO K01527 > 

RIKEN DNA Bank Human Resource - BTF3

Gene ID NCBI Gene 689 |  KEGG hsa:689
Gene Symbol BTF3
Protein Name basic transcription factor 3
Synonyms BETA-NAC|BTF3a|BTF3b|NACB
Ortholog resources KEGG ortholog (KEGG orthology K01527) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053644 IRAK134B20 pCMV-SPORT6 BC061913 NM_001207 Full/var
HGY081211 IRAL003A11 pOTB7 BC008062 NM_001207 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044506 ARe11E10 pKA1U5 NM_001207.4  
TGAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTTATCTCAGGTGGTCCACCCGAGAC
HKR048504 ARe21E08 pKA1U5 NM_001207.4  
AGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACCC
HKR048860 ARe22C12 pKA1U5 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR049771 ARe24H03 pKA1U5 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGNGCCTAATCTCAGGTGGTCCACCC
HKR050836 ARe27B12 pKA1U5 NM_001207.4  
GCTTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR053655 ARe34C07 pKA1U5 NM_001207.4  
AGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACCC
HKR055307 ARe38E11 pKA1U5 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGNGCCTAATCTCAGGTGGTCCACCC
HKR056949 ARe42G05 pKA1U5 NM_001207.4  
GGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACCCCTT
HKR060055 ARe50C07 pKA1U5 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR060974 ARe52H06 pKA1U5 NM_001207.4  
TGCTTTAGCTGCCATCTTTGCGTCCCCGCGTGCCCNCTTTNATAATCTCAGGTGGTCCAC
HKR074883 ARe87D11 pKA1U5 NM_001207.4  
GGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACCCCTT
HKR076130 ARe90F10 pKA1U5 NM_001207.4  
GCTTTTTTTTAGCTGCCATCTTGCGTTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCC
HKR076947 ARe92G03 pKA1U5 NM_001207.4  
GAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACC
HKR077305 ARe93E09 pKA1U5 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR081255 ARf03C07 pKA1U5 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGNTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR163321 ARi08F01 pGCAP10 NM_001207.4  
GATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACCCCTTGAG
HKR171308 ARi28E12 pGCAP10 NM_001207.4  
GCTCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCAC
HKR172979 ARi32H11 pGCAP10 NM_001207.4  
GAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACC
HKR176876 ARi42D04 pGCAP10 NM_001207.4  
CTTTTTTTTTAACTTAGGGACTTCAAAGTCCCTAAGATGTGTTTCTACCATAAATTAATA
HKR177724 ARi44F04 pGCAP10 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR178922 ARi47F02 pGCAP10 NM_001207.4  
GCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGA
HKR187324 ARi68F04 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR208064 ARiS020C16 pGCAP10 NM_001207.4  
TGCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR218338 ARiS045O02 pGCAP10 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR219781 ARiS049H13 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR235228 ARiS088B04 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR238560 ARiS096G16 pGCAP10 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR238569 ARiS096H01 pGCAP10 NM_001207.4  
GCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGA
HKR238736 ARiS096N24 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR264441 ARiS161B17 pGCAP10 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR327236 RBb18B12 pKA1U5 NM_001207.4  
GGTCACTTCCGGCCTCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCT
HKR330452 RBb26C04 pGCAP1 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR333376 RBb33H08 pGCAP1 NM_001207.4  
GTCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACC
HKR342059 RBb55C11 pGCAP1 NM_001207.4  
TGCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTTGCGCCTAATCTCAGGTGGTCCACCC
HKR360574 RBd01H06 pGCAP10 NM_001207.4  
GCTCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCAC
HKR361212 RBd03A12 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR370973 RBd27H05 pGCAP10 NM_001207.4  
TGGCATTTTTTTCACTTTTTTTTTTTTTTGCATTCTTGTTCTTGGGGCTATGACACAGTA
HKR373275 RBd33D03 pGCAP10 NM_001207.4  
GGCGCCTAATCTCAGGTGGTCCACCCGAGACCCCTTGAGCACCAACCCTAGTCCCCCGCG
HKR373276 RBd33D04 pGCAP10 NM_001207.4  
HKR375603 RBd39A03 pGCAP10 NM_001207.4  
GCCTTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR377626 RBd44B02 pGCAP10 NM_001207.4  
GCCTTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR378555 RBd46G11 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR381626 RBd54B02 pGCAP10 NM_001207.4  
GGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCNACCCGAGACCCCTT
HKR382526 RBd56F06 pGCAP10 NM_001207.4  
GGCCCTTTNCCGCGNANNGGGGGGCCNGNGTGTGTGCGNCNNNNNNNNNGGGGNCCATCA
HKR386956 RBd67G12 pGCAP10 NM_001207.4  
GGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACCCCTT
HKR387330 RBd68F10 pGCAP10 NM_001207.4  
GAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACC
HKR390121 RBd75F01 pGCAP10 NM_001207.4  
GCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCC
HKR395680 RBd89D08 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR405745 RBdS014G01 pGCAP10 NM_001207.4  
GCTCCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCAC
HKR409007 RBdS022I15 pGCAP10 NM_001207.4  
CGGCCGGCCGATGAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGT
HKR420406 RBdS051A06 pGCAP10 NM_001207.4  
GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
HKR444280 RBdS110L16 pGCAP10 NM_001207.4  
TTTTTTTTTTTTTTTTTTTTTTTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGGGCG
HKR444319 RBdS110N07 pGCAP10 NM_001207.4  
GAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACC
HKR453010 RBdS132I18 pGCAP10 NM_001207.4  
GAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACC
HKR453125 RBdS132N13 pGCAP10 NM_001207.4  
GAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCGAGACC
HKR470946 RBdS177G02 pGCAP10 NM_001207.4  
GNCNNTAGCTGCCNTCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl