Prev. |  Human A to Z list >  B >  BTF3 > 

RBdS051A06 - NRCD Human cDNA Clone

Catalog Number HKR420406
Clone Name RBdS051A06
Clone info. Plasmid clone of human BTF3 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GCCTTTAGCTGCCATCTTGCGTCCCCGCGTGTGTGCGCCTAATCTCAGGTGGTCCACCCG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_001207.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) BTF3 (NCBI Gene 689)  other clone of BTF3 in our bank
Synonyms BETA-NAC|BTF3a|BTF3b|NACB
Protein Name basic transcription factor 3
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR420406 RBdS051A06 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS051A06 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR420406).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.02

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl