DNA Bank Top |  KEGG KO K04570 > 

RIKEN DNA Bank Human Resource - BCL2L1

Gene ID NCBI Gene 598 |  KEGG hsa:598
Gene Symbol BCL2L1
Protein Name BCL2 like 1
Synonyms BCL-XL/S|BCL2L|BCLX|Bcl-X|PPP1R52
Featured content Jak-STAT signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  BCL2L1


External database

human BCL2L1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07524 AxCAhBcl-xL Recombinant adenovirus harboring human BCL-XL    
RDB07335 pGL4-phBCL2L1 Promoter collection, Human BCL2L1 promoter    
RDB05228 pAxCALNLhBCL-XL(forward) Shuttle vector to generate rAd expressing human BCL2L1    
RDB02043 pAxCAhBcl-xs Shuttle vector to generate rAd Human Bcl-xs expression    
RDB02042 AxCAhBclxs Recombinant adenovirus expressing human Bcl-xs regulated by CAG promoter    
RDB02022 AxCAhAS-BclXL Recombinant adenovirus expressing antisense gene for human BclXL    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048450 ARe21C02 pKA1U5 NM_138578.1  
GCTCGATCCGGGCGATGGAGGAGGAAGCAAGCGAGGGGGCTGGTTCCTGAGCTTCGCAAT
HKR056555 ARe41G11 pKA1U5 NM_138578.1  
GGGANTTTGAATGTAGGTGGTGCGGGGGAGCGCCCATTGANCCCNCCNTCNTANGCNANA
HKR074483 ARe86D11 pKA1U5 NM_138578.1  
GGCTTTCGATTTGACTTAAGTGAAGTATCTTGGAACCTAGACCCAGACCTTCGTAAGACC
HKR078831 ARe97B07 pKA1U5 NM_138578.1  
NNGGCNATNGATCGAGGCAAGCNAGCCGAGGGGGCTGNTTTNCTGTANNNTNNNANTTNC
HKR203309 ARiS008E13 pGCAP10 NM_138578.1  
TGGCGGAGCTGGTTTTTTTGCCAGCCACCGCGAGGCCGGCTGAGTTACCGGCATCCCCGC
HKR238659 ARiS096K19 pGCAP10 NM_138578.1  
GATTCCTGTGTCGCCTTCTGGGCTCCCAGCCTGCCGGGTCGCATGATCCCTCCGGCCGGA
HKR336078 RBb40D06 pGCAP1 NM_138578.1  
GGGAGAAGACGGGGGTAGAAAAGGCTGGTGGGAGATTCAGAGTCCACTGGTGCTTTCGAT
HKR420662 RBdS051K22 pGCAP10 NM_138578.1  
GGCAGCCGGCCCACCCTGGGCTCCGGAGAGGTGCAGCCCCCGGCCCCGGAGCCCTCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl