Prev. |  KEGG KO K04570 > 

RIKEN DNA Bank Human Resource - BCL2L1

Gene ID NCBI Gene 598 |  KEGG hsa:598
Gene Symbol BCL2L1
Protein Name BCL2 like 1
Synonyms BCL-XL/S|BCL2L|BCLX|Bcl-X|PPP1R52
Ortholog resources KEGG ortholog (KEGG orthology K04570) in the DNA Bank
Featured content Jak-STAT signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02022 AxCAhAS-BclXL Recombinant adenovirus expressing antisense gene for human BclXL
RDB02042 AxCAhBclxs Recombinant adenovirus expressing human Bcl-xs regulated by CAG promoter
RDB02043 pAxCAhBcl-xs Shuttle vector to generate rAd Human Bcl-xs expression
RDB05228 pAxCALNLhBCL-XL(forward) Shuttle vector to generate rAd expressing human BCL2L1
RDB07335 pGL4-phBCL2L1 Promoter collection, Human BCL2L1 promoter
RDB07524 AxCAhBcl-xL Recombinant adenovirus harboring human BCL-XL

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048450 ARe21C02 pKA1U5 NM_138578.1  
GCTCGATCCGGGCGATGGAGGAGGAAGCAAGCGAGGGGGCTGGTTCCTGAGCTTCGCAAT
HKR056555 ARe41G11 pKA1U5 NM_138578.1  
GGGANTTTGAATGTAGGTGGTGCGGGGGAGCGCCCATTGANCCCNCCNTCNTANGCNANA
HKR074483 ARe86D11 pKA1U5 NM_138578.1  
GGCTTTCGATTTGACTTAAGTGAAGTATCTTGGAACCTAGACCCAGACCTTCGTAAGACC
HKR078831 ARe97B07 pKA1U5 NM_138578.1  
NNGGCNATNGATCGAGGCAAGCNAGCCGAGGGGGCTGNTTTNCTGTANNNTNNNANTTNC
HKR203309 ARiS008E13 pGCAP10 NM_138578.1  
TGGCGGAGCTGGTTTTTTTGCCAGCCACCGCGAGGCCGGCTGAGTTACCGGCATCCCCGC
HKR238659 ARiS096K19 pGCAP10 NM_138578.1  
GATTCCTGTGTCGCCTTCTGGGCTCCCAGCCTGCCGGGTCGCATGATCCCTCCGGCCGGA
HKR336078 RBb40D06 pGCAP1 NM_138578.1  
GGGAGAAGACGGGGGTAGAAAAGGCTGGTGGGAGATTCAGAGTCCACTGGTGCTTTCGAT
HKR420662 RBdS051K22 pGCAP10 NM_138578.1  
GGCAGCCGGCCCACCCTGGGCTCCGGAGAGGTGCAGCCCCCGGCCCCGGAGCCCTCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl