Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051K22

Clone ID RBdS051K22
HP ID HP03564
Gene ID 598
Gene Symbol BCL2L1
Protein Name BCL2-like 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138578.1
Length of RefSeq (bp) 2575
Chromosome 20q11.21
Reference DDBJ accession
UniGene Hs.516966
5'-terminal sequence GGCAGCCGGCCCACCCTGGGCTCCGGAGAGGTGCAGCCCCCGGCCCCGGAGCCCTCCCGG
2011.08.28