Prev. |  KEGG KO K19716 > 

RIKEN DNA Bank Human Resource - AUP1

Gene ID NCBI Gene 550 |  KEGG hsa:550
Gene Symbol AUP1
Protein Name AUP1 lipid droplet regulating VLDL assembly factor
Synonyms -
Ortholog resource in our bank

  AUP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027948 IRAK069O12 pCMV-SPORT6 BC033646 NM_181575 Full
HGY081484 IRAL003L20 pOTB7 BC001658 NM_181575 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082412 ARf06A12 pKA1U5 NM_181575.3  
GGCCTTCCCAAGAGCCCCTGCGGCCGGGCGCGAAAATGGCGGCGGCGGCGACGGCCGGGC
HKR390108 RBd75E12 pGCAP10 NM_181575.3  
GGCGCGAAAATGGCGGCGGCGGCGACGGCCGGGCGCTCCTGAAGCAGCAGTTATGGAGCT
HKR441709 RBdS104E13 pGCAP10 NM_181575.3  
GGCCCCTGCGGCCGGGCGCGAAAATGGCGGCGGCGGCGACGGCCGGGCGCTCCTGAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl