Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104E13

Clone ID RBdS104E13
HP ID HP03063
Gene ID 550
Gene Symbol AUP1
Protein Name ancient ubiquitous protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_181575.3
Length of RefSeq (bp) 1612
Chromosome 2p13
Reference DDBJ accession
UniGene Hs.411480
5'-terminal sequence GGCCCCTGCGGCCGGGCGCGAAAATGGCGGCGGCGGCGACGGCCGGGCGCTCCTGAAGCA
2011.08.28