Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5O

Gene ID (NCBI) 539
Gene Symbol ATP5O
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Synonyms ATPO|OSCP
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02137)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY090551 IRAL026G07 pOTB7 BC021233 NM_001697 Full
HGY092906 IRAL032E10 pDNR-LIB BC022865 NM_001697 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042812 ARe07A12 pKA1U5 NM_001697.2  
GGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGNCTCTCCCGGCAGGTGCGATGCTTCAGT
HKR052059 ARe30C11 pKA1U5 NM_001697.2  
GGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCAGT
HKR060851 ARe52C03 pKA1U5 NM_001697.2  
GGAGAAGATGGCTGCCCCAGNANTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCAGNAC
HKR063210 ARe58A10 pKA1U5 NM_001697.2  
GGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTT
HKR066901 ARe67E05 pKA1U5 NM_001697.2  
GGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCAGT
HKR247489 ARiS118M01 pGCAP10 NM_001697.2  
GGACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGC
HKR260005 ARiS150A05 pGCAP10 NM_001697.2  
GGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCAGT
HKR322057 RBb05C09 pKA1U5 NM_001697.2  
GCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCA
HKR323657 RBb09C09 pKA1U5 NM_001697.2  
GCTCTTCCCACTCGGGTTTGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTG
HKR330926 RBb27F06 pGCAP1 NM_001697.2  
GCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCA
HKR369305 RBd23E09 pGCAP10 NM_001697.2  
GGGGTTTGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCC
HKR374427 RBd36B03 pGCAP10 NM_001697.2  
GCTCTTCCCACTCGGGTTTGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTG
HKR342125 RBb55F05 pGCAP1 NM_001697.2  
ACAGGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCG
HKR342532 RBb56F12 pGCAP1 NM_001697.2  
GCTTCCCACTCGGGTTTGACCTACAGCCGCCCGGGTAGAAGATGGCTGCCCCAGCAGTGT
HKR344901 RBb62E05 pGCAP1 NM_001697.2  
HKR388522 RBd71F02 pGCAP10 NM_001697.2  
GGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAG
HKR399356 RBd98G12 pGCAP10 NM_001697.2  
GAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCAGTACC
HKR420496 RBdS051D24 pGCAP10 NM_001697.2  
GCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTG
HKR420653 RBdS051K13 pGCAP10 NM_001697.2  
GCTCTTCCCACTCGGGTTTGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTG
HKR442264 RBdS105K24 pGCAP10 NM_001697.2  
TGGATTAAGCAATACCCAAGGAGTCGTTTCTGCCTTTTCTACCATGATGAGTGTCCATCG
HKR453015 RBdS132I23 pGCAP10 NM_001697.2  
GGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAG
HKR462577 RBdS156H09 pGCAP10 NM_001697.2  
GGGGAGAAGATGGCTGCCCCAGCAGTGTCCGGGCTCTCCCGGCAGGTGCGATGCTTCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl