Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051K13

Clone ID RBdS051K13
HP ID HP00375
Gene ID 539
Gene Symbol ATP5O
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001697.2
Length of RefSeq (bp) 815
Chromosome 21q22.11
Reference DDBJ accession
UniGene Hs.409140
5'-terminal sequence GCTCTTCCCACTCGGGTTTGACCTACAGCCGCCCGGGAGAAGATGGCTGCCCCAGCAGTG
2011.08.28