Prev. |  KEGG KO K03662 > 

RIKEN DNA Bank Human Resource - ATP6AP1

Gene ID NCBI Gene 537 |  KEGG hsa:537
Gene Symbol ATP6AP1
Protein Name ATPase H+ transporting accessory protein 1
Synonyms 16A|ATP6IP1|ATP6S1|Ac45|CF2|VATPS1|XAP-3|XAP3
Ortholog resources KEGG ortholog (KEGG orthology K03662) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082952 IRAL007G08 pOTB7 BC000724 NM_001183 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051324 ARe28F04 pKA1U5 NM_001183.4  
TGGCTGAGGCAGTGGAGGCTGAGGCTATGATGGCGGCCATGGCGACGGCTCGAGTGCGGA
HKR080528 ARf01F08 pKA1U5 NM_001183.4  
GAGTGGAGGCTGAGGCTATGATGGCGGCCATGGCGACGGCTCGAGTGCGGATGGGGCCGC
HKR336524 RBb41F04 pGCAP1 NM_001183.4  
GAGTGGAGGCTGAGGCTATGATGGCGGCCATGGCGACGGCTCGAGTGCGGATGGGGCCGC
HKR428151 RBdS070G07 pGCAP10 NM_001183.4  
GAGTGGAGGCTGAGGCTATGATGGCGGCCATGGCGACGGCTCGAGTGCGGATGGGGCCGC
HKR452884 RBdS132D12 pGCAP10 NM_001183.4  
GAGTGGAGGCTGAGGCTATGATGGCGGCCATGGCGACGGCTCGAGTGCGGATGGGGCCGC
HKR471105 RBdS177M17 pGCAP10 NM_001183.4  
GACCTGATCTGCGGCTGTCGAGGCCGCTGAGGCAGTGGAGGCTGAGGCTATGATGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl